|
Addgene inc
phic31 attb sequence Phic31 Attb Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phic31 attb sequence/product/Addgene inc Average 90 stars, based on 1 article reviews
phic31 attb sequence - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Addgene inc
phic31 ![]() Phic31, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phic31/product/Addgene inc Average 93 stars, based on 1 article reviews
phic31 - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Promega
luciferase reporter plasmid pgl4.21-attb ![]() Luciferase Reporter Plasmid Pgl4.21 Attb, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/luciferase reporter plasmid pgl4.21-attb/product/Promega Average 90 stars, based on 1 article reviews
luciferase reporter plasmid pgl4.21-attb - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
attb recombination site (ccgcggtgcgggtgccag ggcgtgcccttgggctccccgggcgcgtactccac) ![]() Attb Recombination Site (Ccgcggtgcgggtgccag Ggcgtgcccttgggctccccgggcgcgtactccac), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/attb recombination site (ccgcggtgcgggtgccag ggcgtgcccttgggctccccgggcgcgtactccac)/product/Thermo Fisher Average 90 stars, based on 1 article reviews
attb recombination site (ccgcggtgcgggtgccag ggcgtgcccttgggctccccgggcgcgtactccac) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Oxford Nanopore
whole genome sequencing ![]() Whole Genome Sequencing, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/whole genome sequencing/product/Oxford Nanopore Average 90 stars, based on 1 article reviews
whole genome sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
BestGene Inc
phic31 ![]() Phic31, supplied by BestGene Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phic31/product/BestGene Inc Average 90 stars, based on 1 article reviews
phic31 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Qidong Gaitianli Pharmaceutical Co
phic31 transposase ![]() Phic31 Transposase, supplied by Qidong Gaitianli Pharmaceutical Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phic31 transposase/product/Qidong Gaitianli Pharmaceutical Co Average 90 stars, based on 1 article reviews
phic31 transposase - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Promega
luciferase reporter plasmid pgl4.21 ![]() Luciferase Reporter Plasmid Pgl4.21, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/luciferase reporter plasmid pgl4.21/product/Promega Average 90 stars, based on 1 article reviews
luciferase reporter plasmid pgl4.21 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Addgene inc
phic31 integrase ![]() Phic31 Integrase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phic31 integrase/product/Addgene inc Average 91 stars, based on 1 article reviews
phic31 integrase - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
|
Millipore
1-thioglycerol ![]() 1 Thioglycerol, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/1-thioglycerol/product/Millipore Average 90 stars, based on 1 article reviews
1-thioglycerol - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
BestGene Inc
pge-gmr-attb ![]() Pge Gmr Attb, supplied by BestGene Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pge-gmr-attb/product/BestGene Inc Average 90 stars, based on 1 article reviews
pge-gmr-attb - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Communications Biology
Article Title: Genetic switches designed for eukaryotic cells and controlled by serine integrases
doi: 10.1038/s42003-020-0971-8
Figure Lengend Snippet: a Flow cytometry distribution of HEK 293T cells at 48 h post transfection for Ints 13, phiC31, and Bxb1, the integrases that led to the highest EGFP-expressing cell frequencies. The heat map indicates the scattering of high cell concentrations (warm colors) to low cell concentrations (cool colors). The gate encompasses the EGFP-expressing cell population. b Bar graph plots showing the total average percentage and standard deviation of a cell population expressing EGFP in biological repeat assays ( n = 3) and circles showing the technical duplicate or triplicate average of each assay on the y axis. The x axis contains the different conditions. For each Int data group, different letters indicate significant differences ( p < 0.05). c Amplicons obtained through PCR analysis using two specific primer sets, the first set to verify attL formation and the second set to verify attR (highlighted in Fig. ). The expected amplicon sizes in the Int test groups varied from 1021 to 1104 bp for attL and from 1058 to 1084 bp for attR . d Bar graph plots showing the viable cells average (circles corresponding to technical replicates averages) and standard deviation normalized with pGFP of OD measurements obtained after MTT assays ( n = 3). DMSO corresponds to the impairment negative control. Negative control cells were transfected with only one of the two vector sets, that is, integrase expression (pIE) or switch GFP (pSG) vectors. Positive control cells (pGFP) have an egfp sequence in the forward orientation under the control of the EF1 alpha promoter. All the data are representative of two or three technical and three biological replicates.
Article Snippet: For the switch GFP vectors, the egfp coding sequence (
Techniques: Flow Cytometry, Transfection, Expressing, Standard Deviation, Amplification, Negative Control, Plasmid Preparation, Positive Control, Sequencing, Control
Journal: Communications Biology
Article Title: Genetic switches designed for eukaryotic cells and controlled by serine integrases
doi: 10.1038/s42003-020-0971-8
Figure Lengend Snippet: The human cell lineage HEK 293T, bovine fibroblasts and A. thaliana protoplasts were the selected model systems. The first step involved the design of two plasmid sets: the integrase expression vectors to express Ints 2, 4, 5, 7, 9, 13, phiC31, or Bxb1 and the switch GFP vectors with the attB and attP recognition sites of the respective Int flanking an egfp coding sequence in a reverse complement (rc) orientation. Acting as a schematic AND gate, combination of the corresponding plasmids of each of the vector sets results in the second step in the process, the test, accomplished by cotransfection or cotransformation assays of mammalian and plant cells, respectively. The third and last step led to the development of analytical methods that include the inputs of an additional schematic AND gate. Microscopy/flow cytometry analyses were used to detect EGFP fluorescence in cells resulting from the flipping action of the integrase. PCR/sequencing was used in the analysis of the egfp coding sequence rotated to the correct forward orientation flanked by the formed attL and attR sites. Both analytical inputs provide evidence of the activated switch vector output. The PCRs used one primer pair to amplify the complete attL site and the entire egfp coding sequence, now in the forward orientation (blue), and a second primer pair to amplify the complete attR site and the egfp sequence (red).
Article Snippet: For the switch GFP vectors, the egfp coding sequence (
Techniques: Plasmid Preparation, Expressing, Sequencing, Cotransfection, Microscopy, Flow Cytometry, Fluorescence
Journal: Communications Biology
Article Title: Genetic switches designed for eukaryotic cells and controlled by serine integrases
doi: 10.1038/s42003-020-0971-8
Figure Lengend Snippet: a Flow cytometry distribution of protoplasts at 24 h post cotransformation for Ints 2, 4, 7, 9, 13, phiC31, and Bxb1, the integrases that led to the highest EGFP-expressing cell frequencies. The heat map indicates the scattering of high cell concentrations (warm colors) to low cell concentrations (cool colors). The gate encompasses the EGFP-expressing cell population. b Bar graph plots showing the total average percentage and standard deviation of a cell population expressing EGFP in biological repeat assays (n in Supplementary Table ) and circles showing the technical triplicate average of each assay on the y axis. The x axis contains the different conditions. For each Int data group, different letters indicate significant differences ( p < 0.05). c Amplicons obtained through PCR analysis using two specific primer sets, the first set to verify attL formation and the second set to verify attR (highlighted in Fig. ). The expected amplicon sizes in the Int test groups varied from 948 to 983 bp for attL and from 1136 to 1132 bp for attR . Negative control cells were transfected with only one of the two vector sets, that is, integrase expression (pIE) or switch GFP (pSG) vectors, plus a mock plasmid. Positive control cells (pGFP) have an egfp sequence in the forward orientation under the control of the CaMV 35S promoter. All the data are representative of three technical and three or more biological replicates. d Bar graph plots showing the viable cells average (circles corresponding to technical replicates averages) and standard deviation normalized with mock plasmid positive cells obtained after FDA assays. DMSO corresponds to the impairment negative control. The cells were transfected with pIE vectors in technical triplicates and three biological replicates (except for Int 7, for which there was three technical and two biological replicates).
Article Snippet: For the switch GFP vectors, the egfp coding sequence (
Techniques: Flow Cytometry, Expressing, Standard Deviation, Amplification, Negative Control, Transfection, Plasmid Preparation, Positive Control, Sequencing, Control
Journal: Communications Biology
Article Title: Genetic switches designed for eukaryotic cells and controlled by serine integrases
doi: 10.1038/s42003-020-0971-8
Figure Lengend Snippet: a Flow cytometry distribution of PBMCs at 48 h post electroporation for GFP switch tests with Int 13 and Bxb1, the integrases that led to the highest EGFP-expressing cell frequencies. The heat map indicates the scattering of high cell concentrations (warm colors) to low cell concentrations (cool colors). The gate encompasses the EGFP-expressing cell population. b Bar graph plots showing the total average percentage and standard deviation of a cell population expressing EGFP in biological repeat assays ( n = 3) and circles corresponding to single data points from each donor material. The x axis contains the different conditions. In the PBMCs assays, Ints 2, 13, phiC31, and Bxb1 were evaluated. c Amplicons obtained through PCR analysis using two specific primer sets, the first set to verify attL formation and the second set to verify attR (highlighted in Fig. ). The expected amplicon sizes in the Int test groups varied from 1021 to 1104 bp for attL and from 1058 to 1084 bp for attR . Negative control cells were electroporated with only one of the two vector sets, that is, integrase expression (pIE) or switch GFP (pSG) vectors. Positive control cells (pGFP) have an egfp sequence in the forward orientation under the control of the EF1 alpha promoter. All the data were representative of three donors, corresponding to biological triplicates with single measurements.
Article Snippet: For the switch GFP vectors, the egfp coding sequence (
Techniques: Flow Cytometry, Electroporation, Expressing, Standard Deviation, Amplification, Negative Control, Plasmid Preparation, Positive Control, Sequencing, Control
Journal: Communications Biology
Article Title: Genetic switches designed for eukaryotic cells and controlled by serine integrases
doi: 10.1038/s42003-020-0971-8
Figure Lengend Snippet: Flow cytometry distribution of NSCs ( a ) and hES cells ( b ) at 48 h post electroporation for GFP switch tests with Ints 2, 9, 13, phiC31, and Bxb1. The heat map indicates the scattering of high cell concentrations (warm colors) to low cell concentrations (cool colors). The gate encompasses the EGFP-expressing cell population. Bar graph plots showing the total average percentage and standard deviation of NSCs ( c ) and hES cell ( d ) populations expressing EGFP in biological repeat assays ( n = 3 for NSCs; n = 2 for hES cells) and circles showing the technical triplicate average of each assay on the y axis. The x axis contains the different conditions. In the stem cell assays, Ints 2, 9, 13, phiC31, and Bxb1 were evaluated. Negative control cells were transfected with only one of the two vector sets, that is, integrase expression (pIE) or switch GFP (pSG) vectors. Positive control cells (pGFP) have an egfp sequence in the forward orientation. All the data are representative of three technical and three (NSCs) or two (hES cells) biological replicates.
Article Snippet: For the switch GFP vectors, the egfp coding sequence (
Techniques: Flow Cytometry, Electroporation, Expressing, Standard Deviation, Negative Control, Transfection, Plasmid Preparation, Positive Control, Sequencing